Journal: Journal of Neuroimmune Pharmacology

Article Title: Differential Effects of Cannabinoid Receptor 2 Agonists on HIV Replication and Inflammatory Activation in Monocyte-Derived Macrophages and Induced Pluripotent Stem Cell-Derived Microglia

doi: 10.1007/s11481-025-10254-x

Figure Lengend Snippet: CB 2 activation reduces the number of infected cells without altering HIV receptor expression. a , b. Bulk RNA-seq analysis showing the expression of key endocannabinoid system genes in ( a ) MDMs and ( b ) iMg. c. Representative images of iMg immunostained for CD4 (red), CCR5 (green), and DAPI (blue). d. Quantification of CD4 and CCR5 expression. Each symbol represents the average of 2 wells/condition. n = 3 differentiations from 2 iMg lines. e. Representative images of iMg immunostained for HIV p24. f. Quantification of CD4 and CCR5 expression. Each symbol represents the average of 2 wells/condition. n = 3 differentiations from 2 iMg lines. One-way analysis of variance (ANOVA) with Dunnett’s correction for multiple comparisons. * p < 0.05; ns, not significant

Article Snippet: Custom TaqMan assay plates preloaded with the following human primer/probe pairs (Thermo Fisher Scientific, Waltham, MA) were used: GAPDH , Hs02786624_g1; CD4 , Hs01058407_m1, CCR5 , Hs99999149_s1; CXCR4 , Hs00607978_s1; CNR1 , Hs01038522_s1; CNR2 , Hs00361490_m1; GPR55 , Hs00271662_s1; IL1B , Hs01555410_m1; IL18 , Hs01038788_m1; NLRP3 , Hs00918082_m1; PYCARD , Hs01547324_gH; IL6 , Hs00174131_m1; TNFA , Hs00174128_m1; and CASP1 , Hs00354836_m1.

Techniques: Activation Assay, Infection, Expressing, RNA Sequencing

Journal: Journal of Neuroimmune Pharmacology

Article Title: Differential Effects of Cannabinoid Receptor 2 Agonists on HIV Replication and Inflammatory Activation in Monocyte-Derived Macrophages and Induced Pluripotent Stem Cell-Derived Microglia

doi: 10.1007/s11481-025-10254-x

Figure Lengend Snippet: CB 2 agonists dose-dependently reduce HIV replication in macrophages and microglia. a , b. HIV p24 levels in supernatants of monocyte-derived macrophages (MDMs, n = 7) ( a ) and human induced pluripotent stem cell-derived microglia (iMg, n = 3) ( b ), normalized to the HIV + vehicle. Two-way ANOVA with Dunnett’s correction for multiple comparisons. * p < 0.05, ** p < 0.01. c , d. Bulk RNA-seq data showing count/million reads of key endocannabinoid system genes in MDMs ( c ) and iMg ( d )

Article Snippet: Custom TaqMan assay plates preloaded with the following human primer/probe pairs (Thermo Fisher Scientific, Waltham, MA) were used: GAPDH , Hs02786624_g1; CD4 , Hs01058407_m1, CCR5 , Hs99999149_s1; CXCR4 , Hs00607978_s1; CNR1 , Hs01038522_s1; CNR2 , Hs00361490_m1; GPR55 , Hs00271662_s1; IL1B , Hs01555410_m1; IL18 , Hs01038788_m1; NLRP3 , Hs00918082_m1; PYCARD , Hs01547324_gH; IL6 , Hs00174131_m1; TNFA , Hs00174128_m1; and CASP1 , Hs00354836_m1.

Techniques: Derivative Assay, RNA Sequencing

Journal: Journal of Neuroimmune Pharmacology

Article Title: Differential Effects of Cannabinoid Receptor 2 Agonists on HIV Replication and Inflammatory Activation in Monocyte-Derived Macrophages and Induced Pluripotent Stem Cell-Derived Microglia

doi: 10.1007/s11481-025-10254-x

Figure Lengend Snippet: CB 2 agonists reduce global cytokine release following HIV infection in MDMs but not in iMg. a , b. Cytokine levels in cell-free supernatants of MDM ( a ) and ( b ) iMg cultures were measured with Bio-Plex Pro 48-Plex human cytokine screening panel. Heatmaps show log 2 fold changes from the HIV + vehicle condition. Supernatants were pooled from 4 wells/condition at days postinfection 9 (DPI 9) and assayed in duplicate. n = 6 MDM donors and 3 iMg lines. Student’s t test, ** p < 0.01. c. Levels of cytokines reportedly associated with HIV-induced brain injury in MDM and iMg supernatants, measured with Bio-Plex Pro 48-Plex human cytokine screening panel. d , e. Levels of tumor necrosis factor alpha (TNF-α) and IL-6 in ( d ) MDM and ( e ) iMg culture supernatants, measured with AlphaLISA. n = 6 MDM donors and 3 iMg lines. Student’s t test, * p < 0.05

Article Snippet: Custom TaqMan assay plates preloaded with the following human primer/probe pairs (Thermo Fisher Scientific, Waltham, MA) were used: GAPDH , Hs02786624_g1; CD4 , Hs01058407_m1, CCR5 , Hs99999149_s1; CXCR4 , Hs00607978_s1; CNR1 , Hs01038522_s1; CNR2 , Hs00361490_m1; GPR55 , Hs00271662_s1; IL1B , Hs01555410_m1; IL18 , Hs01038788_m1; NLRP3 , Hs00918082_m1; PYCARD , Hs01547324_gH; IL6 , Hs00174131_m1; TNFA , Hs00174128_m1; and CASP1 , Hs00354836_m1.

Techniques: Infection

Journal: Journal of Neuroimmune Pharmacology

Article Title: Differential Effects of Cannabinoid Receptor 2 Agonists on HIV Replication and Inflammatory Activation in Monocyte-Derived Macrophages and Induced Pluripotent Stem Cell-Derived Microglia

doi: 10.1007/s11481-025-10254-x

Figure Lengend Snippet: RNA-seq identifies convergent and divergent responses to CB 2 signaling between HIV-infected MDMs and iMg. a , b . Top 10 GO biological process gene sets enriched in the significant differentially expressed genes (DEGs) in comparison between HIV-infected/vehicle-treated and HIV-infected/JWH-133 treated ( a ) MDMs and ( b ) iMg. c. Top 10 KEGG gene sets enriched in the significant DEGs in comparison between HIV-infected/JWH-133-treated MDMs and iMg. n = 2 MDM donors and 2 iMg lines

Article Snippet: Custom TaqMan assay plates preloaded with the following human primer/probe pairs (Thermo Fisher Scientific, Waltham, MA) were used: GAPDH , Hs02786624_g1; CD4 , Hs01058407_m1, CCR5 , Hs99999149_s1; CXCR4 , Hs00607978_s1; CNR1 , Hs01038522_s1; CNR2 , Hs00361490_m1; GPR55 , Hs00271662_s1; IL1B , Hs01555410_m1; IL18 , Hs01038788_m1; NLRP3 , Hs00918082_m1; PYCARD , Hs01547324_gH; IL6 , Hs00174131_m1; TNFA , Hs00174128_m1; and CASP1 , Hs00354836_m1.

Techniques: RNA Sequencing, Infection, Comparison

Journal: Journal of Neuroimmune Pharmacology

Article Title: Differential Effects of Cannabinoid Receptor 2 Agonists on HIV Replication and Inflammatory Activation in Monocyte-Derived Macrophages and Induced Pluripotent Stem Cell-Derived Microglia

doi: 10.1007/s11481-025-10254-x

Figure Lengend Snippet: CB 2 activation has minimal impact on transcriptional priming of the NLRP3 inflammasome in MDMs and iMg with established HIV infection. (a) NLRP3 inflammasome gene expression in MDMs on DPI 9, determined with qRT-PCR, represented as log 2 fold change from Mock + Veh. n = 3 MDM donors. (b) NLRP3 inflammasome gene expression in iMg on DPI 9, determined with bulk RNA-seq. n = 3 iMg lines

Article Snippet: Custom TaqMan assay plates preloaded with the following human primer/probe pairs (Thermo Fisher Scientific, Waltham, MA) were used: GAPDH , Hs02786624_g1; CD4 , Hs01058407_m1, CCR5 , Hs99999149_s1; CXCR4 , Hs00607978_s1; CNR1 , Hs01038522_s1; CNR2 , Hs00361490_m1; GPR55 , Hs00271662_s1; IL1B , Hs01555410_m1; IL18 , Hs01038788_m1; NLRP3 , Hs00918082_m1; PYCARD , Hs01547324_gH; IL6 , Hs00174131_m1; TNFA , Hs00174128_m1; and CASP1 , Hs00354836_m1.

Techniques: Activation Assay, Infection, Gene Expression, Quantitative RT-PCR, RNA Sequencing

Journal: Journal of Neuroimmune Pharmacology

Article Title: Differential Effects of Cannabinoid Receptor 2 Agonists on HIV Replication and Inflammatory Activation in Monocyte-Derived Macrophages and Induced Pluripotent Stem Cell-Derived Microglia

doi: 10.1007/s11481-025-10254-x

Figure Lengend Snippet: In iMg, CB 2 -specific agonists impair HIV-induced NLRP3 inflammasome activation with a corresponding increase in autophagosome number. (a) Quantification of the number of NLRP3 + /ASC + specks in iMg detected with immunostaining. Average of 2 wells/condition from 3 differentiations in 2 iMg lines, one-way ANOVA with Dunnett’s correction for multiple comparisons. * p < 0.05. (b) Autophagic vacuoles measured by an autophagy assay. n = 3 iMg lines, one-way ANOVA with Dunnett’s correction for multiple comparisons, * p < 0.05. (c) Caspase 1 activity measured by the Caspase-Glo 1 inflammasome assay, with results normalized to HIV + Veh. n = 3 iMg lines, one-way ANOVA with Dunnett’s correction for multiple comparisons, * p < 0.05. (d) Levels of IL-1β in iMg supernatants, measured by AlphaLISA. n = 3 iMg lines, one-way ANOVA with Dunnett’s correction for multiple comparisons, ** p < 0.01; ns, not significant

Article Snippet: Custom TaqMan assay plates preloaded with the following human primer/probe pairs (Thermo Fisher Scientific, Waltham, MA) were used: GAPDH , Hs02786624_g1; CD4 , Hs01058407_m1, CCR5 , Hs99999149_s1; CXCR4 , Hs00607978_s1; CNR1 , Hs01038522_s1; CNR2 , Hs00361490_m1; GPR55 , Hs00271662_s1; IL1B , Hs01555410_m1; IL18 , Hs01038788_m1; NLRP3 , Hs00918082_m1; PYCARD , Hs01547324_gH; IL6 , Hs00174131_m1; TNFA , Hs00174128_m1; and CASP1 , Hs00354836_m1.

Techniques: Activation Assay, Immunostaining, Activity Assay

Journal: Acta biochimica Polonica

Article Title: Fatty acid amide hydrolase (FAAH) inhibitor PF-3845 reduces viability, migration and invasiveness of human colon adenocarcinoma Colo-205 cell line: an in vitro study.

doi: 10.18388/abp.2017_1520

Figure Lengend Snippet: Figure 3. Survival curves for Colo-205 exposed to FAAH inhibi tor PF-3845 alone or co-incubated with selected antagonists: AM 251 (CB1 receptor antagonist), AM 630 (CB2), SB 366791 (TRPV1), RN 1734 (TRPV4) and G-15 (GPR30). Each point represents mean of 5 independent determinations. Standard deviations were excluded for clarity and did not exceed 12% of the mean value for each point.

Article Snippet: The membrane was then washed in TBS-T and hybridized with primary rabbit CB1 and CB2 polyclonal antibodies (Santa Cruz Biotechnology, Dallas, TX, USA), which were diluted to a suitable concentration (1:200 – 1:500) in TBS-T, for 16 h. Additionally, the membranes were incubated with a goat polyclonal antibody specific for β-actin (1:100 000 dilution) to use as a loading control.

Techniques: Incubation

Journal: Acta biochimica Polonica

Article Title: Fatty acid amide hydrolase (FAAH) inhibitor PF-3845 reduces viability, migration and invasiveness of human colon adenocarcinoma Colo-205 cell line: an in vitro study.

doi: 10.18388/abp.2017_1520

Figure Lengend Snippet: Figure 4. Effect of PF-3845 on CB1 and CB2 receptor expression in the Colo-205 cells. (A) Cells were treated with PF-3845 for 48 h and subjected to Western blot analysis. PF-3845 decreased expression of CB1 and in creased expression of CB2 receptor. (B) β-actin in the cell lysate is shown as control. Each blot is representative of at least three oth er blots. Density values of the bands are graphically expressed rel ative to control. Data are shown as mean ± S.D. (n=4). Significance of differences between means: *p<0.05 versus control; ***p<0.001 versus control. Figure 5. Inhibition of Colo-205 cell migration by PF-3845 in the concentration range of 0 to 100 µM. Migration studies were conducted using BD FalconTM 24-Multiwell Insert plate system. Total area of inserts with crystal violet-stained cells was photographed and counted using the NIH ImageJ analy sis software. (A) Representative images obtained for Colo-205 are shown above graphs. Initial magnification: x 200. (B) Each value on the graph represents the mean value ± S.D., n=3 independent ex periments. Significance of differences between means: ***p<0.001 versus control.

Article Snippet: The membrane was then washed in TBS-T and hybridized with primary rabbit CB1 and CB2 polyclonal antibodies (Santa Cruz Biotechnology, Dallas, TX, USA), which were diluted to a suitable concentration (1:200 – 1:500) in TBS-T, for 16 h. Additionally, the membranes were incubated with a goat polyclonal antibody specific for β-actin (1:100 000 dilution) to use as a loading control.

Techniques: Expressing, Western Blot, Control, Inhibition, Migration, Concentration Assay, Staining, Software

Journal: Arthritis Research & Therapy

Article Title: Elevated serum immunoglobulin level predicts high risk of 1-year recurrence in patients with Takayasu arteritis

doi: 10.1186/s13075-023-03016-8

Figure Lengend Snippet: CD138 expressions in the aortic wall of TAK and control group. A CD138 staining in the aortic wall of TAK patients and control group (scale bars, 100 μm; n = 3 in control group, n = 4 in TAK group). B The quantification of CD138 staining in the two groups ( n = 3 in control group, n = 4 in TAK group)

Article Snippet: Then, they were stained with primary antibody for CD138 (Item No.ab46506, Abcam, Cambridge, CB2 0AX, UK) overnight at 4 °C and secondary antibody for 0.5–1 h at room temperature and detected with 3,3′-diaminobenzidine.

Techniques: Control, Staining

Journal: Cannabis and Cannabinoid Research

Article Title: Expression of Cannabinoid Receptors in Human Osteoarthritic Cartilage: Implications for Future Therapies

doi: 10.1089/can.2015.0001

Figure Lengend Snippet: Immunohistochemical staining for cannabinoid receptor expression, CB1, CB2, GPR55, GPR18, TRPV1, PPARα, and PPARγ in OA articular cartilage and bone together with rabbit IgG control. CB, cannabinoid; GPR, G-protein-coupled receptor; OA, osteoarthritis; PPAR, peroxisome proliferator-activated receptors; TRPV, transient receptor potential vanilloid.

Article Snippet: Samples were incubated overnight at 4°C with rabbit polyclonal antibodies (Abcam) against CB1 (1:100) (ab23703), CB2 (1:50)(ab3561), PPARα (1:250)(ab8934), PPARγ (1:50)(ab19481), and TRPV1 (1:1000)(ab63083), and rabbit polyclonal antibodies from Acris (Acris GmbH) against GPR55 (1:100)(SP4239P) and GRP18 (1:200)(AP06930PU).

Techniques: Immunohistochemical staining, Staining, Expressing, Control

Journal: Cannabis and Cannabinoid Research

Article Title: Expression of Cannabinoid Receptors in Human Osteoarthritic Cartilage: Implications for Future Therapies

doi: 10.1089/can.2015.0001

Figure Lengend Snippet: Quantitative analysis of immunopositivity of cannabinoid receptors in each zone of articular cartilage and bone. (A) CB1 immunopositivity. (B) CB2 immunopositivity. (C) GPR55 immunopositivity. (D) GPR18 immunopositivity. (E) TRPV1 immunopositivity. (F) PPARα immunopositivity. (G) PPARγ immunopositivity. * p <0.05, ** p <0.01, *** p <0.001. DZ, deep zone; MZ, middle zone; SZ, superficial zone.

Article Snippet: Samples were incubated overnight at 4°C with rabbit polyclonal antibodies (Abcam) against CB1 (1:100) (ab23703), CB2 (1:50)(ab3561), PPARα (1:250)(ab8934), PPARγ (1:50)(ab19481), and TRPV1 (1:1000)(ab63083), and rabbit polyclonal antibodies from Acris (Acris GmbH) against GPR55 (1:100)(SP4239P) and GRP18 (1:200)(AP06930PU).

Techniques:

Journal: Cannabis and Cannabinoid Research

Article Title: Expression of Cannabinoid Receptors in Human Osteoarthritic Cartilage: Implications for Future Therapies

doi: 10.1089/can.2015.0001

Figure Lengend Snippet: Quantitative analysis of immunopositivity of cannabinoid receptors in the deep zone of OA articular cartilage. (A) CB1 immunopositivity. (B) CB2 immunopositivity. (C) GPR55 immunopositivity. (D) GPR18 immunopositivity. (E) TRPV1 immunopositivity. (F) PPARα immunopositivity. (G) PPARγ immunopositivity. (H) Correlation of grade of cartilage degeneration and GPR18 immunopositivity. * p <0.05. ID, intermediate degeneration; LD, low degeneration; ND, nondegenerate; SD, severe degeneration.

Article Snippet: Samples were incubated overnight at 4°C with rabbit polyclonal antibodies (Abcam) against CB1 (1:100) (ab23703), CB2 (1:50)(ab3561), PPARα (1:250)(ab8934), PPARγ (1:50)(ab19481), and TRPV1 (1:1000)(ab63083), and rabbit polyclonal antibodies from Acris (Acris GmbH) against GPR55 (1:100)(SP4239P) and GRP18 (1:200)(AP06930PU).

Techniques:

Journal: Cannabis and Cannabinoid Research

Article Title: Expression of Cannabinoid Receptors in Human Osteoarthritic Cartilage: Implications for Future Therapies

doi: 10.1089/can.2015.0001

Figure Lengend Snippet: Quantitative analysis of immunopositivity of cannabinoid receptors in osteocytes. (A) CB1 immunopositivity. (B) CB2 immunopositivity. (C) GPR55 immunopositivity. (D) GPR18 immunopositivity. (E) TRPV1 immunopositivity. (F) PPARα immunopositivity. (G) PPARγ immunopositivity. (H) Immunopositivity within osteocytes for PPARγ within the underlying bone correlation with grade of cartilage degradation for tissue sample. * p <0.05.

Article Snippet: Samples were incubated overnight at 4°C with rabbit polyclonal antibodies (Abcam) against CB1 (1:100) (ab23703), CB2 (1:50)(ab3561), PPARα (1:250)(ab8934), PPARγ (1:50)(ab19481), and TRPV1 (1:1000)(ab63083), and rabbit polyclonal antibodies from Acris (Acris GmbH) against GPR55 (1:100)(SP4239P) and GRP18 (1:200)(AP06930PU).

Techniques:

Journal: Acta histochemica

Article Title: Immunohistochemical distribution of cannabinoid receptor type 1 (CB1) and type 2 (CB2) in the rat carotid body.

doi: 10.1016/j.acthis.2024.152205

Figure Lengend Snippet: Fig. 1. Immunohistochemistry for CB1 and CB2 in the carotid body. (A) Dot-like CB1 immunoreactivity is observed throughout the carotid body. Intense immu- noreactivity is shown in nerve fibers and/or endings (arrows). (B) A higher magnification view of the rectangle in panel A. Dot-like CB1 immunoreactivity is observed in the perinuclear cytoplasm of chemoreceptor cells (arrows). Intense immunoreactivity for CB1 is also present in nerve endings (arrowheads). (C) Dot-like CB2 immunoreactivity is noted throughout the carotid body. (D) A higher magnification view (rectangle in panel C) shows small dots of CB2 immunoreactivity in the perinuclear region of chemoreceptor cells (arrow). (E-G) Double immunofluorescence for CB1 and CB2 shows CB1-immunoreactive (arrows) and CB2- immunoreactive dots (arrow heads) in the same chemoreceptor cell; however, they are not colocalized.

Article Snippet: CB2: A rabbit polyclonal anti-CB2 antibody (NB300–606, Novus Biologicals, Centennial, CO, U.S.A.) was raised from a fusion protein that contained the first 33 amino acid residues of human CB2.

Techniques: Immunohistochemistry, Immunofluorescence

Journal: Acta histochemica

Article Title: Immunohistochemical distribution of cannabinoid receptor type 1 (CB1) and type 2 (CB2) in the rat carotid body.

doi: 10.1016/j.acthis.2024.152205

Figure Lengend Snippet: Fig. 2. (A-C)Triple immunofluorescence for CB1 with TH and DBH. CB1-immunoreactive dot-like structures are observed in both TH- (arrows) and DBH- immunoreactive chemoreceptor cells (arrowheads). Dot-like immunoreactivity for CB1 localizes in both the perinuclear cytoplasm and outlines of the regions of immunoreactivity for TH or DBH. (D-F) Triple immunofluorescence for CB2 with TH and DBH. CB2 immunoreactivity is shown in the perinuclear cytoplasm of TH- (arrows) and DBH-immunoreactive chemoreceptor cells (arrowheads).

Article Snippet: CB2: A rabbit polyclonal anti-CB2 antibody (NB300–606, Novus Biologicals, Centennial, CO, U.S.A.) was raised from a fusion protein that contained the first 33 amino acid residues of human CB2.

Techniques: Immunofluorescence

Journal: Acta histochemica

Article Title: Immunohistochemical distribution of cannabinoid receptor type 1 (CB1) and type 2 (CB2) in the rat carotid body.

doi: 10.1016/j.acthis.2024.152205

Figure Lengend Snippet: Fig. 3. (A-C) Double immunofluorescence for CB1 with P2X3. Intense CB1 immunoreactivity is surrounded by P2X3 immunoreactivity in the sensory nerve endings around chemoreceptor cells (arrows). (D-F) Double immunofluorescence for CB1 with VGluT2. CB1 immunoreactivity colocalizes with VGluT2 immunoreactivity, and appears to be in close contact with chemoreceptor cells (arrows). (G-H) Double immunofluorescence for CB2 with P2X2. Weak CB2-immunoreactive dots localize within P2X2-immunoreactive sensory nerve endings (arrows).

Article Snippet: CB2: A rabbit polyclonal anti-CB2 antibody (NB300–606, Novus Biologicals, Centennial, CO, U.S.A.) was raised from a fusion protein that contained the first 33 amino acid residues of human CB2.

Techniques: Immunofluorescence

Journal: Archives of Virology

Article Title: Functional variation (Q63R) in the cannabinoid CB2 receptor may affect the severity of COVID-19: a human study and molecular docking

doi: 10.1007/s00705-021-05223-7

Figure Lengend Snippet: Allele and genotype frequencies of the Q63R polymorphism in subjects (n = 200)

Article Snippet: Extracted samples were genotyped for the CNR2 rs35761398 (Q63R) variant using a TaqMan assay with commercial primers and probes (Thermo Fisher, USA): 5’CTGTGAAGGTCATAGTCACGCT3’ (F primer), 5’CTCTTCTGGGCCTGCTAAGTG3’ (R primer), and CAGGTATGAGGGCTTCCGGCGGAG [CC/TT] GGTGGGAGGACAGGATCAGATAGA [VIC/FAM] (Probes).

Techniques:

Journal: Archives of Virology

Article Title: Functional variation (Q63R) in the cannabinoid CB2 receptor may affect the severity of COVID-19: a human study and molecular docking

doi: 10.1007/s00705-021-05223-7

Figure Lengend Snippet: Association of the Q63R polymorphism with COVID-19 severity (n = 200, crude analysis) under different inheritance models

Article Snippet: Extracted samples were genotyped for the CNR2 rs35761398 (Q63R) variant using a TaqMan assay with commercial primers and probes (Thermo Fisher, USA): 5’CTGTGAAGGTCATAGTCACGCT3’ (F primer), 5’CTCTTCTGGGCCTGCTAAGTG3’ (R primer), and CAGGTATGAGGGCTTCCGGCGGAG [CC/TT] GGTGGGAGGACAGGATCAGATAGA [VIC/FAM] (Probes).

Techniques:

Journal: Archives of Virology

Article Title: Functional variation (Q63R) in the cannabinoid CB2 receptor may affect the severity of COVID-19: a human study and molecular docking

doi: 10.1007/s00705-021-05223-7

Figure Lengend Snippet: Demographics, gender, and clinical form according to Q63R polymorphism

Article Snippet: Extracted samples were genotyped for the CNR2 rs35761398 (Q63R) variant using a TaqMan assay with commercial primers and probes (Thermo Fisher, USA): 5’CTGTGAAGGTCATAGTCACGCT3’ (F primer), 5’CTCTTCTGGGCCTGCTAAGTG3’ (R primer), and CAGGTATGAGGGCTTCCGGCGGAG [CC/TT] GGTGGGAGGACAGGATCAGATAGA [VIC/FAM] (Probes).

Techniques: